Original Article

The diagnostic analysis of the presumptive cases of foot and mouth disease (FMD) vaccine-associated adverse reaction in Korea

Hyeon Seop Byeon1https://orcid.org/0000-0003-1919-483X, Mi Na Han1https://orcid.org/0000-0002-0865-4530, Seong Tae Han1https://orcid.org/0000-0001-7163-1529, Shin Seok Kang1https://orcid.org/0000-0002-6759-9324, Rae Hoon Jang1https://orcid.org/0000-0001-6766-2592, Chang Seop Kim1https://orcid.org/0000-0002-7069-4971, You Chan Bae2https://orcid.org/0000-0001-6456-4735, Bo Young Jeon3https://orcid.org/0000-0002-4314-216X, Byeongwoo Ahn4,*https://orcid.org/0000-0002-4112-7724
Author Information & Copyright ▼
1Chungbuk Veterinary Service and Laboratory, Cheongju 28153, Korea
2Animal Disease Diagnostic Division, Animal and Plant Quarantine Agency, Gimcheon 39660, Korea
3Department of Biomedical Laboratory Science, College of Health Science, Yonsei University, Wonju 26493, Korea
4College of Veterinary Medicine, Chungbuk National University, Cheongju 28644, Korea
*Corresponding author: Byeongwoo Ahn, College of Veterinary Medicine, Chungbuk National University, Cheongju 28644, Korea, Tel: +82-43-261-2508, E-mail: bwahn@cbu.ac.kr

© Research Institute of Veterinary Medicine, Chungbuk National University.

Received: Dec 09, 2021; Revised: Dec 14, 2021; Accepted: Dec 14, 2021

Abstract

We conducted diagnostic investigations to analyze the causes of abortions (46 cases, 65.7%), deaths (22 cases, 31.4%) and muscular lesions (2 cases, 2.9%) occurred after foot and mouth disease (FMD) vaccination in livestock farms in Korea. Bacterial culture, enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) were performed to detect the causative agents of abortion in bovine and caprine. The diagnostic results showed that 36 (51.4%) cases, referring as “Identified”, were occurred by influence of underlying disease including bovine viral diarrhea (12 cases, 17.1%), neosporosis (7 cases, 10.0%), septicemic colibacillosis (5 cases, 7.1%), Q fever (4 cases, 5.7%) and other abnormal conditions (8 cases, 11.4%) not by vaccination. Other 2 (3.0%) cases were suspected to be vaccine-associated adverse reaction on the basis of pathological findings (shock lung, oil-component-induced granuloma) and clinical symptoms (dyspnea with pulmonary edema). The other 32 (45.7%) cases were determined “Unknown” because any pathogens and pathological changes were not identified. However, many of the “Unknown” cases were presumptive to be the vaccine-related adverse reaction based on epidemiological investigation, especially, the cases which showed the clinical signs within 2 days after the vaccination. It is important to conduct pathological, microbilogical and epidemiological investigation to diagnose whether the cases are from vaccine-associated adverse reaction or not.

Keywords: adverse reactions; foot-and-mouth disease; FMD vaccine

INTRODUCTION

Foot and mouth disease (FMD), one of the most contagious diseases, has a great potential for serious economic losses in animal industry. That is why most countries are strongly conducting the sanitary prophylaxis (quarantine in immigration, animal movement restriction, preventive slaughter of animals, etc.) and the medical prophylaxis (vaccination) in order to control the disease. In endemic countries, vaccination is estimated to be quite effective. Countries concerned about sporadic outbreaks, such as Argentina, Bolivia, Botswana, Brazil, Colombia, Kazakhstan, and Malaysia, maintain its FMD-free status through vaccination.

In Korea, a nationwide vaccination was first implemented in response to the massive outbreak in 2010. Afterward, the outbreaks have dramatically decreased. Although FMD has occurred sporadically since 2014, the intensive nationwide vaccinations have been strongly implemented every year, especially at the time of special prevention season (October to May) or when FMD is likely to occur or develop [1]. However, irrespective of the effectiveness, there have been frequent complaints that the vaccine might be a cause of abortions or deaths. In response to such complaints, Korea government conducted official survey to examine the causal relationship between the vaccination and those events in 2011. That survey failed to find any confirmed cases of adverse reactions, including abortion or death, due to FMD vaccination. Some vaccinated animals, however, experienced stress, fever, pain, loss of appetite, lethargy, a temporary decrease in milk production or a retarded growth rate.

Despite the report, the number of submitted cases due to abortion or death has been significantly increased after annual intensive inoculation practice. It has been serious problems in the livestock farms for many years. Some farmers tend to distrust or avoid the vaccination and even require to stop vaccination. It is now an obstacle to the FMD control policy. However, there were few actual informations to solve the distrust against the FMD vaccine. Therefore, it is necessary and important to identify the causes of those coincident events, and inform the actual field situations to resolve the disputes between the government and the farmers through the laboratory diagnosis.

MATERIALS AND METHODS

Preparation of samples

From January, 2017 to June, 2018, 70 cases (46 abortions, 22 deaths, 2 muscular lesions from 63 cattles, 6 goats and 1 pig) considered to have shown adverse reactions against the vaccination were submitted to Chungbuk Veterinary Service and Laboratory. We conducted diagnostic procedures including bacteriologic, virologic and histopathologic examinations according to the standard guidelines for animal disease diagnosis [2]. According to the guidelines, samples within 2 weeks and in good condition were utilized for the diagnosis.

Pathological examinations

Necropsies on 70 cases were carried out precisely in accordance with standard pathological procedure. On the lesion checked during necropsy, specific procedures including bacterial isolation, viral gene amplification and pathological examination were applied. In order to observe histopathologic findings of the lesions, the main organs including brain, liver, heart, kidney, spleen, intestine and placenta were fixed in 10% neutral formalin for 24 hours, followed by routine tissue processing and paraffin embedment. The paraffin sections (2 μm thickness) were stained with hematoxylin-eosin for microscopy. The different stains including immunohistochemistry were also done if necessary.

Bacterial examinations

In order to isolate bacteria from the lesions, both Sheep Blood agar and MacConkey agar were used for general aerobic and anaerobic culture. When single colonies observed after incubation, MALDI-TOF (MicroflexTM Bruker, Billericay, MA, USA) was utilyzed for identification of the bacterial colonies.

Polymerase chain reaction (PCR) in aborted cases

Gene amplifications were performed for the agents causing abortion in bovine or caprine such as Brucella abortus, Coxiella burnetii, Campylobacter fetus, Listeria monocytogenes, Leptospira spp., Chlamydophila abortus, Neospora caninum, Toxoplasma gondii, bovine viral diarrhea virus (BVDV), infectious bovine rhinotrachitis virus (IBRV), Ainovirus (AINOV), Chuzan virus (CHUV), Akabane virus (AKAV), Ibaraki virus (IBAV), bovine ephemeral fever virus (BEFV). DNA/RNA were extracted from various tissue samples using a Viral Gene-spinTM Viral DNA/RNA Extraction kit (Intron, Seongnam, Korea) according to the manufacturer’s instructions. The primer sequences used for the PCR are shown in Table 1. For amplification of the viral genes, commercial viral detection kits were used for AINOV, CHUV, AKAV, IBAV, and BEFV (MEDIAN diagnosticsTM, Chuncheon, Korea) and for BVDV (PowerCheckTM, Kogenebiotech, Seoul, Korea). Briefly, 20 μL of PCR mixture contained 0.5 μL of 10 pmol of each primer, 3 μL of template and 16 μL of free water in the PCR mastermix (i-StartTaq, INTRONTM). The each PCR conditions were applied as described in references indicated in Table 1.

Table 1. Nucleotide sequences of primers used for PCR amplification
Target organisms Target gene Sequence (5’→3’) Product size (bp) Reference
Bacteria Brucella abortus 16s RNA TCGAGCGCCCGCAAGGGG 905 [3]
AACCATAGTGTCTCCACTAA
Coxiella burnetii IS1111 TATGTATCCACCGTAGCCAGTC 687 [4]
CCCAACAACACCTCCTTATTC
Listeria monocytogenes hly CGGAGGTTCCGCAAAAGATG 234 [5]
CCTCCAGAGTGATCGATGTT
Leptospiraspp. secY CTGAATCGCTGTATAAAAGT 285 [6]
GGAAAACAAATGGTCGGAAG
Chlamydophila abortus pmp ATGAAACATCCAGTCTACTGG 300 [7]
TTGTGTAGTAATATTATCAAA
Protozoa Neospora caninum Nc-5 CTCGCCAGTCAACCTACGTCTTCT 350 [8]
CCCAGTGCGTCCAATCCTGTAAC
Toxoplasma gondii B1 GGAACTGCATCCGTTCATGA 501 [9]
CAGACGAATCACGGAACTG
Virus IBRV gC TACGACTCGTTCGCGCTCTC 476 [10]
GGTACGTCTCCAAGCTGCCC

PCR, polymerase chain reaction; IBRV, infectious bovine rhinotrachitis virus.

Download Excel Table
Antibody detection

Enzyme-linked immunosorbent assay (ELISA) for the antibody detection was performed for Coxiella burnetii and Neospora canis using commercial ELISA kits (Idexx, Tampa, FL, USA), and plate agglutination test for Brucella abortus using Rose bengal agent provided from Animal and Plant Quarantine Agency.

Statistical analysis

The distributions of categorical variables (the number of occurrence of cases from the day of vaccination to 14th day) were compared by a chi-square test between “Identified” and “Unknown” with SPSS 25.0. P values of <0.05 were considered to be significant.

RESULTS

Clinical conditions of presumptive vaccine-associated adverse reaction cases were summarized at Table 2. The occurrence of the reactions according to age are shown at Table 3 and 4. The diagnostic results were summarized at Table 5. Briefly, from the total 70 cases, 39 (55.7%) cases, referred to “Identified”, were identified to have the reasonable causes of abortions, death or muscular lesions. On the other hand, 31 (44.3%) cases, referred to “Unknown”, were animals that any lesions or causative agents have not been identified through the diagnostic procedures. From the 39 “Identified” cases, the causes of 22 abortion cases were composed of BVD (11), neosporosis (7), mummification (2), Q fever (1) and Akabane disease (1) in bovine and Q fever (3) and listeriosis (1) in caprine. The causes of 10 deaths in bovine were colibacillosis (5), dyspnea with pulmonary edema (1), BVD (1), mannheimiosis with severe fibrinopurulent pneumonia (1), septicemia by bone fracture (1) and tympany (1). In caprine, luminal acidosis (1) and muscular lesions (2) pyogranulomous myositis by oil component in FMD vaccine and eosinophilic granulomatous myositis by sarcocystis infection were diagnosed.

Table 2. Summary of clinical conditions showed in animals inoculated with FMD vaccine
Conditions No. of cases (%)
Total Bovine Caprine Porcine
70 (100) 63 (100) 6 (100) 1 (100)
Abortions 46 (65.7) 41 (65.0) 5 (83.3) -
Deaths 22 (31.4) 21 (33.4) 1 (16.7) -
Muscular lesions 2 (2.8) 1 (1.6) - 1 (100)

FMD, foot and mouth disease.

Download Excel Table
Table 3. Classification of 46 aborted fetuses from the vaccinated animals by age (month)
Causes Total (%) No. of fetuses (%)
3 4 5 6 7 8 9
Unknown 20 (100) - - - 3 (15) 4 (20) 5 (25) 8 (40)
Identified 26 (100) 2 - 6 3 3 7 5
Download Excel Table
Table 4. Classification of 22 death cases from the vaccinated animals by age
Causes Total No. of cases (%)
1–4 d 5–8 d 1 m 5 m 7 m 8 m 2 yr 3yr 4 yr
Unknown 11 3 (27.3) 4 (36.4) 3 (27.3) 1 (9.1) - - - - -
Identified 11 - 4 (36.4) 1 (9.1) - 1 (9.1) 1 (9.1) 2 (18.2) 1 (9.1) 1 (9.1)

d, days; m, months; yr, years.

Download Excel Table
Table 5. The diagnostic results on 70 presumptive cases of FMD vaccine-associated adverse reaction
Clinical condition (No.) Animal (No.) Diagnostic results
Causes of condition No. of cases (%)
Abortion (46) Bovine (41) Unknown (19) Unknown 19 (27.1)
Bovine viral diarrhea 11 (15.7)
Identified (22) Neosporosis 7 (10.0)
Mummification without any pathogen 2 ( 2.9)
Q fever 1 ( 1.4)
Akabane disease with hydrocephalus 1 ( 1.4)
Caprine (5) Unknown (1) Unknown 1 ( 1.4)
Identified (4) Q fever 3 ( 4.3)
Listeriosis 1 ( 1.4)
Death (22) Bovine (21) Unknown (11) Unknown 11 (15.7)
Colibacillosis with severe fibrinous serositis 4 ( 5.7)
Colibacillosis with meningoencephalitis 1 ( 1.4)
Dyspnea with pulmonary edema 1 ( 1.4)
Identified (10) Bovine viral diarrhea 1 ( 1.4)
Mannheimiosis with severe fibrinopurulent pneumonia 1 ( 1.4)
Septicemia due to bone fracture 1 ( 1.4)
Tympany 1 ( 1.4)
Caprine (1) Identified (1) Luminal acidosis 1 ( 1.4)
Muscular lesion (2) Bovine (1) Identified (1) Sarcocystis infection with eosinophilic granulomatous myositis 1 ( 1.4)
Porcine (1) Identified (1) Pyogranulomatous myositis without pathogenic agent 1 ( 1.4)

FMD, foot and mouth disease.

Download Excel Table

One of the “Identified”, there was a fatal bovine case which died of dyspnea with pulmonary edema, suspected to be vaccine-associated adverse reaction. The case was first in Korea that suddenly collapsed and died of severe pulmonary lesions after FMD vaccination. In history, on May 20 in 2017, the cow (Korean indigenous cattle, female, 24 months old, 400 kg, apparently healthy) was inoculated with FMD bivalent (O manisa + O 3039) vaccine (GreenCross Veterinary Product, Yongin, Korea) in the jugular region intramuscularly and suddenly died after vaccination. The farmers injected the vaccine to 10 cattles around 7 o’clock in the morning. Approximately 1 hour later, one of the 10 cattles suddenly became depressed, took a sitting position with labored breathing and then fell down to death (Fig. 1A). Just before the death it showed dyspnea with reddish foamy nasal and oral discharge. On gross examinations, the cow showed severe pulmonary swelling and diffuse reddness in both lobes of the lungs, which failed to collapse when the thoracic cavity was opened. On cut surface, the lung parenchyma was like a wet sponges oozing fluids. The interlobular septae were markedly distended with fluid (Fig. 1B). However, no changes were observed in other internal organs. Histopathologically, the lungs showed severe congestion with the thickening of alveolar walls. The terminal bronchioles and alveoli were diffusely filled with abundant proteinaceous fluid, fibrin, large numbers of erythrocytes, neutrophils, and macrophages. Interlobular septae were markedly thickened by the accumulation of fluid (Fig. 1C). In the liver, severe congestion was observed in various size of vessels (Fig. 1D). In laboratory examinations, no bacteria were isolated from the lungs, kidneys, liver and spleen. The viruses which can cause respiratory diseases including BRSV, IBRV, PI-3 virus, BVDV, and adenovirus were not detected by PCR.

jbtr-22-4-179-g1
Fig. 1. Morphologic features of a dead case after FMD vaccination. (A) A cow died shortly after the vaccination. Note the discharge of sanguineous-foamy fluid from the mouth and the nose. (B) The cut surface of the cow’s lungs. Note the red foamy fluid in the bronchi, and the interlobular septae markedly distended with clear fluid. (C) A microphotograph of the pulmonary lesion. The alveoli are filled with abundant eosinophilic fibrinous inflammatory exudates and RBCs. (D) A micrograph of hepatic lesion. The sinosoids and central veins are severely congested. H&E stain. Scale bars = 200 μm (C), 400 μm (D). FMD, foot and mouth disease.
Download Original Figure

DISCUSSION

Even though vaccination policy for preventing FMD outbreak has been implemented in many countries, there are only few reports on vaccine-induced adverse reaction, making it difficult to estimate the situation related FMD vaccine problem in other countries. In this study, we diagnosed and analyzed various causes of the potential adverse reaction cases related to FMD vaccination in Korea.

Generally, some vaccine used for veterinary purposes often have the potential for adverse reaction in vaccinated animals [11]. Several adverse reaction cases after administration of routine animal vaccine similar to coincidence after FMD vaccination in Korea have been reported in other countries. The calves following administration of a combination vaccine showed fever and depression and died of pulmonary edema in 8 hours, suggesting that synergistical actions among endotoxins or other bacterial components and some adjuvants enhance fatal inflammatory responses [12]. In swine, vaccinated pigs with oil-in-water type adjuvant vaccine against porcine pleuropneumonia showed fever, malaise and anorexia [13]. It was also reported that the components such as safonin and oil emulsion in vaccines might cause chemical stimulation [14]. In the case of FMD vaccine adverse reaction, urticarial, exudative and necrotic dermatitis were observed in dairy cows 8 days later after vaccination, due to anaphylaxis caused by vaccine components [15]. And Ferreira et al. reported that FMD vaccines could elicit inflammatory and acute phase reactions, known to impair cow pregnancy maintenance [16]. Unfortunately, most reports of adverse reactions following vaccination have been anecdotal, and relatively few have been documented in the scientific literature, making it difficult to assess mechanisms by which certain vaccine components, or combinations thereof, may cause adverse reactions [12].

There were various comments about the causes of adverse reaction happening after annual FMD vaccination in Korea. Livestock farmers argued that currently using FMD vaccine with thick oil based feature was severely stressful to the animals and it could be causes of inappetence, death or abortion during or after inoculation. Oil-based adjuvant containing most veterinary vaccine have contributed to the enhancement of veterinary vaccine efficacy and have greatly contributed to the prevention of many epidemics. At the same time, it often caused some side effects such as inflammation, granulomatous lesions and aseptic abscesses at the injection site, fever and anorexia [14]. Most FMD vaccines contain inactivated FMD virus serotypes and an oil-based adjuvant [17]. Some reports documented adjuvant-containing FMD vaccine led to innate immune responses related to antigen presentation to T cell lymphocytes, including inflammation and acute phase reactions [14, 17] known to cause pregnancy loss in cattle [18]. It has been known that adverse reactions such as fever, pain, anorexia, lethargy and decrease in milk production and growth rate occur after the vaccination in domestic livestock farms [13]. It is also reported that excessive emulsifier containing in oil based FMD vaccine temporarily induced clinical signs [13]. Especially, in swine, body temperature could rise to 41°C–42°C after 6–12 hours of inoculation and malaise with anorexia last for several days. Weak animals may consequently show a decrease of daily gain in weight, or worst case may occasionally die. Also, pregnant females may more frequently be provoked to abortion [19]. For these reasons, FMD vaccine manufacturers may acknowledge the potential adverse reaction by notifying them through the user manual for the safe usage of vaccine.

On the other hand, the opinion of Korean government on the livestock farmers’ comments were contrary. According to the official survey conducted by Korea government on whether the cases of animal death or abortion after vaccination were related to FMD vaccine in 2011, the stress induced during fastening the animals for inoculation could cause fever, pain, loss of appetite and lethargy. This could lead to temporary decrease of milk production and/or the growth rate, and there has not yet been confirmed the cases of adverse reactions such as animal death or abortion caused by FMD vaccination [1, 20]. In accordance with the literature, especially Novak W [21], or the veterinary biologic guidelines [22, 23] on the definition of vaccine adverse reaction, even these not-vaccine-related signs were also asserted or considered as the adverse reaction. However, Korean government does not tend to regard the signs such as fever, pain, loss of appetite and lethargy occurring after vaccination as a category of adverse reaction. This was probably because the vaccine adverse reactions were not clearly defined in the relevant regulations, and there was not enough scientific verification procedure on whether adverse reaction were caused directly by vaccine components or during vaccination.

In this study, we confirmed that 51.4% of total 70 cases were not related to vaccine-associated adverse reaction but to underlying diseases. Among these, there were some cases which could be easily distinguishable from the causes through the external appearance of the dead bodies. Especially, some calves with excessive frontal head protrusion related to hydrocephalus, some cattle showing emaciation condition resulting from severe respiratory problem, calves with leg bone fracture or tympany, or mummified fetus could be sufficiently judged that the causes were not related to FMD vaccination, even if farmers were not a specialist. Moreover, BVD or neosporosis were identified as major causes of abortion in this study, which were consistent with the previous study on the situation of bovine abortion in Korea [24]. On the other hand, we could not clearly identify the causative agents or associated lesions which can directly be related to abortion or death in 31 (44.2%) cases. For these cases, we could not judge whether the results were from the adverse reactions or not.

There were differences when compare the occurrence according to animal age and time laps between “Unknown” and “Identified”. Occurrence of “Unknown” was mainly in late stage (7–9 months) of gestation period in abortion cases and within one week after birthday in death cases. On the other hand, in cases of “Identified”, there was no tendency occurred at certain period of time but it tended to depend on the time of onset of underlying disease. This means that vaccination for the pregnant animal at late gestation period or newborn animal (≦ 8th days ) may rise the possibility of vaccine-associated adverse reaction.

And when comparing time laps from at vaccination to occurrence (Fig. 2), the occurrence at early periods (from the 0 day to 2nd days) of “Unknown” were 2.7 times higher than that of “Identified” (p < 0.05). This epidemiological investigation means that there were no other factors to be considered except the direct influence of vaccine or vaccine-related stress.

jbtr-22-4-179-g2
Fig. 2. Comparison of the numbers of occurrence of the event according to time laps between “Identified” and “Unknown”.
Download Original Figure

As the intensive vaccination policy is enhanced, controversies between the government and the farmhouse over the adverse reactions would be continuously repeated. To resolve this problems, it is necessary to clarify the cause of the occurrence through diagnosis and epidemiological examinations, then to offer the results to make the livestock farmers understand the facts. And it is also necessary for the farmers to establish the history database about their usual abortions or deaths so that they can be used for comparative analysis of the unidentified abortions or deaths occurring after the vaccination.

Conflict of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgements

This study was conducted with the budget, a head of experiment and research (20703), of Chungbuk Veterinary Service and Laboratory.

Ethics Approval

Not applicable.

REFERENCES

1.

Park JH. Requirements for improved vaccines against foot-and-mouth disease epidemics. Clin Exp Vaccine Res 2013;2:8-18.

2.

Animal and Plant Quarantine Agency [APQA]. Standard guidelines for animal diagnosis, APQA Article 14, Kimcheon; 2015.

3.

Romero C, Gamazo C, Pardo M, López-Goñi I. Specific detection of Brucella DNA by PCR. J Clin Microbiol 1995;33:615-617.

4.

Vaidya VM, Malik SVS, Kaur S, Kumar S, Barbuddhe SB. Comparison of PCR, immunofluorescence assay, and pathogen isolation for diagnosis of Q-fever in humans with spontaneous abortions. J Clin Microbiol 2008;46:2038-2044.

5.

Aznar R, Alarcon B. PCR detection of Listeria monocytogenes: a study of multiple factors affecting sensitivity. J Appl Microbiol 2003;95:958-966.

6.

Gravekamp C, Van de Kemp H, Franzen M, Carrington D, Schoone GJ, Van Eys GJJM, Everard COR, Hartskeerl RA, Terpstra WJ. Detection of seven species of pathogenic leptospires by PCR using two sets of primers. J Gen Microbiol 1993;139:1691-1700.

7.

Laroucau K, Souriau A, Rodolakis A. Improved sensitivity of PCR for Chlamydophila using pmp gene. Vet Microbiol 2001;82:155-164.

8.

Okeoma CM, Williamson NB, Pomroy WE, Stowell KM, Gillespie L. The use of PCR to detect Neospora caninum DNA in the blood of naturally infected cows. Vet Parasitol 2004; 122:307-315.

9.

Suh M, Shin G. Dectection of Toxoplsma gondii in experimentally infected porcine blood and tissues by polymerase chain reaction. Korean J Vet Res 2001;41:89-98.

10.

Fuchs M, Hübert P, Detterer J, Rziha HJ. Detection of bovine herpesvirus type 1 in blood from naturally infected cattle by using a sensitive PCR that discriminates between wild type virus and virus lacking glycoprotein E. J Clin Microbiol 1999;37:2498-2507.

11.

Smith BP. Large animal internal medicine. 5th ed. St. Louis: Elsevier; 2015.

12.

Ellis JA, Yong C. Systemic adverse reactions in young Simmental calves following administration of a combination vaccine. Can Vet J 1997;38:45-47.

13.

Oda K, Tsukahara F, Kubota S, Kida K, Kitajima T, Hashimoto S. Emulsifier content and side effects of oil-based adjuvant vaccine in swine. Res Vet Sci 2006;81:51-57.

14.

Straw BE, MacLachlan NJ, Corbett WT, Carter PB, Schey HM. Comparison of tissue reactions produced by Haemophilus pleuropneumoniae vaccines made with six different adjuvants in swine. Can J Comp Med 1985;49:149-151.

15.

Yeruham I, Yadin H, Haymovich M, Perl S. Adverse reactions to FMD vaccine. Vet Dermatol 2011;12:197-201.

16.

Ferreira LCL, Cooke RF, Marques RS, Fernandes HJ, Fernandes CE, Stelato R, Franco GL, Lemos RAA. Effects of vaccination against foot-and-mouth disease virus on reproductive performance of Bos indicus beef cows. J Anim Sci 2016;94:401-405.

17.

Rodriguez LL, Grubman MJ. Foot and mouth disease virus vaccines. Vaccine 2009;27: D90-D94.

18.

Hansen PJ, Soto P, Natzke RP. Mastitis and fertility in cattle - possible involvement of inflammation or immune activation in embryonic mortality. Am J Reprod Immunol 2014;51:294-301.

19.

Tizard IR. Veterinary immunology. 7th ed. Philadelphia: Saunders; 2004.

20.

Choi SH, Pak SI. Economic burden of Foot and Mouth Disease vaccination-induced injection site lesions in slaughtered pigs and its causal relationship. J Prev Vet Med 2015;39:153-156.

21.

Novak W. Predicting the “unpredictable” vaccine reactions. Proceedings of North American Veterinary Conference. Ithaca: International Veterinary Information Service; 2007.

22.

Canadian Food Inspection Agency. Reporting suspected adverse reactions. Can Vet J 1998;39:204.

23.

International Cooperation on Harmonization of Technical Requirements for Registration of Veterinary Medicinal Products [VICH]. Pharmacovigilance of veterinary medicinal products: management of adverse event reports. Brussels: VICH; 2007. Report No.: VICH GL 24.

24.

Kim JH, Lee JK, Lee BC, Park BK, Yoo HS, Hwang WS, Shin NR, Kang MS, Jean YH, Yoon HJ, Kang SK, Kim DY. Diagnostic survey of bovine abortion in Korea: with special emphasis on Neospora caninum. J Vet Med Sci 2002;64:1123-1127.