Stimulation of keratinocyte differentiation by extract of combined medicinal plant

Simian virus 40 large T antigen (SV40T)-transformed human epidermal keratinocytes (SV-HEKs) were maintained in keratinocyte-serum free medium (K-SFM) supplemented with bovine pituitary extract and recombinant human epidermal growth factor (Life Technologies Corporation, Grand Island, NY) [12].

All medicinal plants were obtained from Omniherb Co. (Daegu, Korea). Air-dried Taraxacum platycarpum H. Dahlstedt (80 g), Heartleaf Houttuynia (80 g), Glycyrrhiza uralensis Fischer (40 g) and root bark of Ulmus davidiana (40 g) were cut into pieces and extracted with 8 volumes of ethanol for 7 d. The extract was filtered using Whatman paper, evaporated under reduced pressure condition, and then freeze-dried (Eyela, Irvine, CA). For treatment of cultured cells, ECMP was reconstituted in dimethylsulfoxide (DMSO). For topical application, ECMP was reconstituted in 70% polyethylene glycol and 30% ethanol.

SV-HEKs (2 × 10⁵) were seeded on 12-well culture plates then cultured for overnight. Next day, SV-HEKS were treated with ECMP at the indicated concentrations and incubated for 3 d. Cells received 2 mg/mL MTT solution and were incubated for further 4 hr. The medium was removed and the resulting formazan crystal was solubilized in 100 μL of DMSO. The optical density at 540 nm was determined using an ELISA reader.

Cells were lysed in Proprep solution (Intron, Daejeon, Korea). Total protein was measured using a BCA Protein Assay Reagent (Pierce Biotechnology, Rockford, IL). Samples were run on SDS-polyacrylamide gels, transferred onto nitrocellulose membranes and incubated with appropriate antibodies. Blots were then incubated with peroxidase-conjugated secondary antibodies, visualized by enhanced chemiluminescence (Intron). The following primary antibodies were used in Western blot: involucrin (Cat# sc-21748), loricrin (Cat# sc-133757), filaggrin (Cat# sc-30229) (Santa Cruz Biotechnologies, Santa Cruz, CA), and actin (Cat# A2668) (Sigma, St. Louis, MO). Dilution factor for each antibody is 1:1,000.

For creation of involucrin-luc reporter adenovirus (Ad/Inv-luc) and loricrin-luc reporter adenovirus (Ad/Lor-luc), genomic DNA isolated from keratinocytes was used as a template for PCR. Primer sequences were as follows: involucrin promoter, 5’-CTCCATGTGTCATGGGATATG and 5’-TCAACCTGAAAGACAGAAGAG; loricrin promoter, 5’ TACCAAGCAATCCTCTCACCTTGG and 5’-TGAGGAGAGAAGATGCTGGC. The resultant PCR fragments cover from −2,467 to +1,239 base pairs of involucrin transcription site and from −2,033 to +12 base pairs of loricrin transcription site (http://www.ensembl.org/Multi/blastview). The promoter fragments were subcloned into pGL3 vector (Promega, Madison, WI), then moved to pENTR vector and adenoviruses were created.

SV-HEKs were grown at 50% confluency in 12-well culture plates and transduced with reporter adenovirus. After adenoviral transduction, cells were replenished with fresh medium and treated with ECMP. Cells were further incubated for 48 hr and then cellular extracts were prepared using cell lysis buffer. Luciferase activities were determined using Luciferase assay system (Promega, Madison, WI), according to the recommended protocol.

For [³H]thymidine uptake assay, SV-HEKs were seeded in 60-mm culture dish and treated with 1 μCi of [³H]thymidine (Amersham, Buckinghamshire, UK). Following incubation for the indicated time point, cells were washed twice with PBS and incubated with 0.1 N NaOH at room temperature. Radioactivity in cell lysates was measured by liquid scintillation counter.

Seven week old female hairless mice were purchased from Orient Bio Inc. (Seongnam, Korea). Skin barrier was disturbed by tape-stripping and then ECMP was topically applied. TEWL was measured using Tewameter TM210 (Courage + Khazaka electronic GmbH, Cologne, Germany) as previously described [13].

For skin sampling, mice were euthanized by cervical dislocation and then skin specimens were obtained by dissection with scissors. Skin samples were fixed in 10% formalin, and embedded in paraffin. Paraffin sections of skin specimens were de-waxed, re-hydrated and washed three times with PBS. Sections were then incubated with proteinase K (Dako, Carpinteria, CA) for 5 min at 37°C, treated with H₂O₂ for 10 min at room temperature, blocked in 0.1% Tween-20, 1% bovine serum albumin in PBS for 30 min, and followed by reaction with anti-mouse filaggrin antibody (Cat# ab24584, Abcam, Cambridge, MA) for 1 hr. Sections were incubated sequentially with peroxidase-conjugated secondary antibody and visualized with Chemmate envision detection kit (Dako, Carpinteria, CA).

Data were evaluated statistically using one-way analysis of variance (ANOVA) with the SPSS software (v 22.0; IBM, Seoul, Korea). Statistical significance was set at P<0.01.

We prepared ECMP using 4 medicinal plants that are used frequently in oriental medicine. First, we determined the cytotoxicity of ECMP on SV40T-transformed human epidermal keratinocytes (SV-HEKs). After treatment for 3 d, ECMP showed no cytotoxicity up to the dose of 10 μg/mL (Fig. 1).

Fig. 1. Cytotoxicity of ECMP. SV-HEKs were treated with ECMP at the indicated concentrations for 3 days. Cell viability was measured by MTT assay. The mean values ± SEM are averages of triplicate measurements. P<0.01.

Download Original Figure

Next, we investigated the effect of ECMP on keratinocyte differentiation. We used calcium, a best known differentiation inducer [14], as a positive control. SV-HEKs were treated with ECMP for 3 d and the data showed that protein level for involucrin and loricrin was markedly increased by ECMP (Fig. 2A). Late differentiation marker filaggrin was also significantly increased after 7 d treatment with ECMP (Fig. 2B). To investigate whether ECMP affected the involucrin and loricrin expression at the promoter level, we tested the promoter activity using the recombinant adenoviruses harboring reporter constructs. As a result, ECMP induced involucrin and loricrin promoter activity (Figs. 2C and 2D). These results indicate that ECMP has a potential to enhance keratinocyte differentiation.

Fig. 2. Effect of ECMP on keratinocyte differentiation. (A) SV-HEKs were treated with ECMP (10 μg/mL) for 3 days. Calcium (1.2 mM) was included as a positive control for keratinocyte differentiation. Cellular proteins were prepared and protein level for differentiation markers was evaluated by Western blot. Actin was used as a loading control. (B) SV-HEKs were treated with ECMP (10 μg/mL) for 7 days. (C) Effect of ECMP on the involucrin promoter activity. SV-HEKs were transduced with 10 multiplicity of infection (MOI) of involucrin-luc reporter adenovirus, then treated with ECMP (10 μg/mL) for 3 days. Cells were lysed and assayed for luciferase activity. Data are represented as fold induction and SEM, measured from three independent experiments. P<0.01. (D) Effect of ECMP on the loricrin promoter activity. SV-HEKs were transduced with 10 MOI of loricrin-luc reporter adenovirus, then processed as same in (C). P<0.01.

Download Original Figure

Since keratinocyte differentiation takes place along a pathway that leads to cell cycle arrest simultaneously, we next investigated the effect of ECMP on cell growth using [³H]thymidine uptake assay. ECMP treatment resulted in retardation of cell growth, similar to the calcium-treated group (Fig. 3).

Fig. 3. Effect of ECMP on the cell growth. SV-HEKs were treated with 10 μg/mL ECMP for the indicated time points in the presence of 1 μCi of [³H]thymidine. Calcium (1.2 mM) was included as a positive control for keratinocyte differentiation. Cells were lysed using 0.1 N NaOH and radioactivity was measured. Data are expressed as count per minute (CPM). The mean values ± SEM are averages of triplicate measurements. P<0.01.

Download Original Figure

Transepidermal water loss (TEWL) is a well established indicator for the disturbance of skin barrier function. To investigate the effect of ECMP on skin barrier function, we disturbed mouse skin barrier by tape-stripping. We then topically applied ECMP and checked the TEWL. As compared with vehicle-treated group, ECMP led to fast recovery of barrier function (Fig. 4A). To further verify the effect of ECMP, we checked the expression of filaggrin by immunohistochemistry. ECMP treatment led to significant increase of filaggrin in granular layer of mouse skin (Fig. 4B).

Fig. 4. Effect of ECMP on skin functionality. (A) Effect of ECMP on transepidermal water loss (TEWL). Hairless mice were tape-stripped, then topically applied with 100 μg/mL solution of ECMP (in 70% polyethylene glycol and 30% ethanol). At the indicated time points, TEWL was measured using Tewameter. Basal TEWL was measure before tape-stripping (BTS). Immediately after tape-stripping, 0.2 mL of vehicle or ECMP solution were topically applied and TEWL was measured (0 hr). In each group, 5 hairless mice were included. Data are average and SEM. P<0.01. (B) Skin specimens were obtained after 3 day treatment. Sections were prepared and stained with anti-filaggrin antibody. In ECMP-treated skin, intense filaggrin staining is seen in granular layers (arrow). Dotted line indicates boundary between epidermis and dermis.

Download Original Figure